Wahl model 9966 software#

The primers were designed by software (premier premier 5.0) as follow: TGF β1 (sense 5 ′ GGCGATACCTCAGCAACCG 3 ′ antisense, 5 ′ CTAAGGCGAAAGCCCTCAAT 3 ′), Smad2 (sense, 5 ′ TACTACTCTTTCCCTGT 3 ′ antisense, 5 ′ TTCTTGTCATTTCTACCG 3 ′), Smad7 (sense, 5 ′ CAACCGCAGCAGTTACCC 3 ′ antisense, 5 ′ CGAAAGCCTTGATGGAGA 3 ′), β-actins (sense, 5 ′ -TCGTGCGTGACATTAAGGAG-3 ′ antisense, 5 ′ - ATGCCAGGGTACATGGTAAT-3 ′). Real-time RT-PCR analysis was performed to identify the expression level of TGF β1, smad2 and smad7 by using SYBR Green mix(ToYoBo Co, Japan). Total RNA of MHCC97-H, MHCC97-L cell lines and tumor tissues were extracted by TRIZOL Reagent (Invitrogen corp, USA) according instruction of the product. After stained with HE, sections were independently observed under microscopic to evaluate pulmonary metastasis by two pathologists. Analysis of pulmonary metastasisĮach lung tissues were sliced for 20 sections with 5μm in thickness, and 50μm interval between two successive sections.

These experiments were approved by the Shanghai Medical Experimental Animal Care Commission, and were in accordance with the Helsinki Declaration of 1975. The tumor and lung tissues were removed and partly cryopreserved in -70☌ for real-time PCR analysis, and partly paraffin embedded for immunohistochemstry or H&E (hematoxylin and eosin) staining. In the end of feeding, animals were sacrificed. According to our experience, to guarantee enough tumor size and pulmonary metastasis, the MHCC97-L models were feed longer (40days) than MHCC97-H models (35days). After tumor formed, the tumor size was estimated according to the formula: volume (mm 3) = 0.5 a 2×b, in which “a” is the major diameter of tumor and “b” is the minor diameter perpendicular to the major one. The models were established as follow: 6×10 6 MHCC97-H and 6×10 6 MHCC97-L cells were inoculated subcutaneously into the right side backs of the nude mice (average weight 25g). Samplesģ1 samples and observed data were selected randomly from our previous experiment, which were tissues of MHCC97-H models (n=20) and MHCC97-L models (n=11). Both cell lines were cultured in high glucose Dulbecco’s modified Eagle's medium (H-DMEM, Gibco) and supplemented with 10% fetal calf serum (Gibco) at 37☌ in a humidified incubator that contained 5% CO 2. These cell lines were clonally selected from the same parent cell lines, MHCC97, they have an identical genetic background. MHCC97-L and MHCC97-H, were human HCC cell lines, and which have a lower and higher metastatic potential respectively. In this study, by comparing the different expression of TGF β/Smads in HCC cell lines, we tried to investigate the correlation between TGF β/Smads levels and potential of pulmonary metastasis in HCC. In several studies, TGF β1 levels are demonstrated to be lower, while, in other studies, the levels are demonstrated to be higher versus healthy individuals. However, although a multitude of studies have presented evidence for TGF β changes in HCC tumors, the direction of the changes is not always consistent. Laminin-5 (Ln-5) and TGF β1 cooperatively induce epithelial mesenchymal transition (EMT) and cancer invasion in HCC. In addition, the role of TGF β1 in HCC metastasis is emphasized. In HCC, TGF β is a useful serologic marker for diagnosis because it shows higher sensitivity than AFP in earlier stage of cancer. Recently, a report indicates that transient exposure of breast cancer cells to TGF β which produced in the primary tumor microenvironment promotes cancer cells to extravagate from blood vessels and entry into the lung by upregulation of the adipokine angiopoietin-like 4. Signaling of TGF β1 play a role mainly through Smad proteins. There are three kinds of molecular in TGF β family, while, TGFβ1 is predominantly and importantly expressed in liver cells, whereas two other members, TGFβ2 and TGFβ3, are present in a little amounts and its roles are even ignored in many studies. Transforming growth factor beta (TGF β) is a known regulator of epithelial cell, autonomous tumor initiation, progression and metastasis. Therefore, to reduce the pulmonary metastasis could ameliorate the prognosis of HCC. The incidence of pulmonary metastasis after hepatic resection for HCC ranges from 37% to 58%. Lung is the most common site for extrahepatic recurrence of HCC. The extremely poor prognosis of HCC is largely the result of a high rate of recurrence after surgery and of metastasis. The overall five-year survival rate following resection has remained as poor as 35–50%. Hepatocellular carcinoma (HCC) is one of the most common cancers in the world.

Wahl model 9966